MIRAP00236-250RXN Display Image

MystiCq microRNA qPCR Assay Primer, hsa-miR-195-5p

Code: MIRAP00236-250RXN D2-231

Features and Benefits

Features and Benefits• Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs• Extensive de...

read more

£94.80 EACH
List Price

Features and Benefits

Features and Benefits• Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs• Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence • No self-complementarity or primer dimer artifacts with the Universal PCR Primer• Optimized primer Tm designed to match the Universal PCR Primer• Universal cycling conditions ensures robust amplification for all assays in profiling experiments• Optimized PCR product Tm (75-78° C)

General description

The MystiCq microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.

Legal Information

MystiCq is a registered trademark of Qiagen Beverly Inc.

Other Notes

Formerly hsa-miR-195. Compatible with mmu-miR-195 and rno-miR-195.

mp~77 °C
Sanger mature/minor accession no.MIMAT0000461
formliquid
storage temp.−20°C
Gene Informationhuman ... MIR195(406971)
shipped inwet ice
concentration10 mg/mL
mature sequenceUAGCAGCACAGAAAUAUUGGC